Archives

  • 2019-10
  • 2019-11
  • 2020-03
  • 2020-07
  • 2020-08
  • br Materials and methods br Human NSCLC cell lines were

    2020-08-12


    2. Materials and methods
    Human NSCLC cell lines were originally obtained from American Type Culture Collection. A549 and H1792 cell lines have been au-thenticated in Microread Gene Technology by STR analysis. H1792, Calu-1, H460, H1975 and A549 cell lines were maintained in RPMI1640 (Sigma Aldrich, R6504) supplemented with 10% (v/v) fetal bovine serum (FBS, Gibco).
    A
    AAMP
    ACTB
    B
    pGIPZ-luc pGIPZ-shAAMP-1 pGIPZ-shAAMP-2
    AAMP
    EGFR
    ACTB
    Fig. 2. Downregulation of AAMP suppressed H1792 xenograft growth in vivo. (A) B-NSG mice were injected with control cells or stably AAMP-silenced cells as indicated. The tumor size was measured every two days. Images show variation of tumor size after 60 days. The error bars represent the SD (n = 5), **P < .01. WB showed AAMP expression in pGIPZ-luc and pGIPZ-shAAMP transfected H1792 cells. (B) The mice were sacrificed on the 82nd day. Tumors were dissected and weights were calculated. The error bars represent the SD, **P < .01. (C) Tumors were dissected from mice and WB detected the level of phospho-EGFR (Y1173), phospho-ERK and AAMP in different group.
    2.3. siRNA and shRNA design
    siAAMP-1 and siAAMP-2 siRNAs targeted the sequence 5′-GAGAG CTGTG GTAGGCTAT-3′ and 5′-CUCUUAGGCAUCAGUGUCA-3′, re-spectively. The lentiviruses containing AAMP 1st and 2nd shRNA were generous gifts from Shanghai Jiao Tong University College of Basic Medical Sciences, Shanghai, China.
    The AAMP ORF sequence was amplified from Calu-1 cDNA using the following primers: sense, 5′-GGG TACCGCCGCCACCATGGAGTCCGAA TCGGAAAGC-3′ and antisense, 5′-GGGATCCTTA ACGGTCAGGCCTTT GGAC-3′. The HA-AAMP sequence was amplified from the pcDNA3.1-AAMP plasmid. EGFR gene with FLAG tag was amplified from H1299 cDNA using the primers: sense, 5′-CGGTACCGCCGCCACCATGCGACC CTCCGGGACGGCCGG GGC-3′ and antisense, 5′-CCTCGAGTCACTTGT CGTCATCGTCTTTGTAGTCTGAAATT CACTGCT-3′.
    2.5. Western blot assay
    Cells were homogenized in lysis buffer on ice for 30 min after 
    washed with PBS. Samples were centrifuged at 13200 rpm for 15 min followed by protein quantification. Proteins were separated by SDS-PAGE and transferred to polyvinylidene difluoride (PVDF) membranes. Membranes were blocked in 5% nonfat powder in PBST for 1 h at room temperature and then immunoblotted with primary HU 308 at 4 °C overnight. After washing with PBS, membranes were incubated with second antibodies conjugated with HRP for 2 h at room temperature. Protein expression was visualized using western blot detection substrate (Millipore, #WBKLS0500).
    2.6. Construction of stable cell lines
    1 μg plasmids containing shRNA sequences (pGIPZ-luc, pGIPZ-shAAMP-1 and pGIPZ-shAAMP-2), 0.25 μg of the envelope plasmid pMD2.G and 0.75 μg of the packaging plasmid psPAX2 were transfected into 293FT cells using Lipofectamine 2000 (Invitrogen). The cell culture media was refreshed 18 h after transfection. Lentivirus supernatant was collected at 48 h and transduced into H1792 cell line for 24 h before cell culture media was refreshed. Monoclonal cells were screened by Puromycin [2 μg/ml] and identified by western blot assay.
    2.7. High-content microscope analysis
    Calu-1 and H1792 cell lines were transfected with 220 nM AAMP siRNAs or 1 μg plasmid pcDNA3.1-AAMP after seeded in 6-well plates. Cells were imaged continuously for 48 h or 60 h using high-content microscope after reseeded in 12-well plates. Cell numbers were counted
    A
    B
    C Transmembrane region
    Input
    IP HA
    Input IP
    IgG
    AAMP antibody - - +
    EGFR
    ETTM
    EGFR
    CTTM
    AAMP
    HA
    CT
    ACTB
    EGFR
    D
    E
    Input
    IP HA
    Input
    IP:HA
    FLAG
    HA
    AAMP
    ACTB
    FLAG
    siCTRL +
    HA
    siAAMP -
    ACTB
    Fig. 3. AAMP interacted with EGFR and promoted dimerization. (A) H1792 cells were transfected with pcDNA3.1-HA-AAMP for 24 h then analyzed by co-im-munoprecipitation analysis and Western blot. (B) IP and HU 308 WB analyses of the interaction of endogenous AAMP and EGFR in H1792 cells. (C) EGFR was divided into 3 fragments, including extracellular and transmembrane fragment (ETTM), cytoplasmic and transmembrane fragment (CTTM) and cytoplasmic fragment (CT). (D) The interaction of AAMP with different fragments of EGFR, including CTTM, CT and ETTM was detected by co-immunoprecipitation assay. Western blot was used for FLAG and HA detection. (E) Co-immunoprecipitation assay was performed in Calu-1 cell after transfection with pcDNA3.1-EGFR-FLAG, pcDNA3.1-EGFR-HA, AAMP siRNA and EGF [5 ng/mL]/5 min treatment. HA, FLAG and AAMP were detected by Western Blot. Graphs represent FLAG/HA ratios in EGF treatment groups (means ± s.e.m.). The error bars represent the SD, *P < .05.
    at various time points using the high-content microscope software.